View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_267 (Length: 213)
Name: NF1111_low_267
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_267 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 30 - 134
Target Start/End: Original strand, 20171390 - 20171494
Alignment:
| Q |
30 |
aaggcaacaattacaaactctttgttgatttgaggttcacttacactgtaacaaggaaataatcacaagccatcttaatgtctatgttcgtttgaattga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20171390 |
aaggcaacaattacaaactctttgttgatttgaggttcacttacactgtaacaaggaaataatcacaagccatcttaatgtctatgttcgtttgaattga |
20171489 |
T |
|
| Q |
130 |
gaata |
134 |
Q |
| |
|
||||| |
|
|
| T |
20171490 |
gaata |
20171494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 30 - 134
Target Start/End: Original strand, 44393100 - 44393204
Alignment:
| Q |
30 |
aaggcaacaattacaaactctttgttgatttgaggttcacttacactgtaacaaggaaataatcacaagccatcttaatgtctatgttcgtttgaattga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44393100 |
aaggcaacaattacaaactctttgttgatttgaggttcacttacactgtaacaaggaaataatcacaagccatcttaatgtctatgttcgtttgaattga |
44393199 |
T |
|
| Q |
130 |
gaata |
134 |
Q |
| |
|
||||| |
|
|
| T |
44393200 |
gaata |
44393204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University