View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_268 (Length: 213)
Name: NF1111_low_268
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_268 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 5 - 134
Target Start/End: Original strand, 36862425 - 36862554
Alignment:
| Q |
5 |
gtgtataaaatttgttgagagagataaataaagcccttaattgtgtgtggatgatacatttgtttacaaagataatagtaatttgaaatatttaatataa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36862425 |
gtgtataaaatttgttgagagagataaataaaccccttaattgtgtgtggatgatacatttgtttacaaagataatagtaatttgaaatatttaatataa |
36862524 |
T |
|
| Q |
105 |
gaagtaaatattcgttactgcaacagctag |
134 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
36862525 |
gaagtaaatattcgttactgcaatagctag |
36862554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University