View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_271 (Length: 210)
Name: NF1111_low_271
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_271 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 32866802 - 32866673
Alignment:
| Q |
1 |
agagaatatgtatattttatgttcacnnnnnnnaaggtacagttcaaatttgtttctatgtattcggttggatttggctgtggagattttacgattacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866802 |
agagaatatgtatattttatgttcactttttttaaggtacagttcagatttgtttctatgtattcggttggatttggctgtggagattttacgattacaa |
32866703 |
T |
 |
| Q |
101 |
gcatgtgaatgttgccgccgctgtgagtat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32866702 |
gcatgtgaatgttgccgccgctgtgagtat |
32866673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University