View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_275 (Length: 207)
Name: NF1111_low_275
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_275 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 49786204 - 49786326
Alignment:
| Q |
1 |
tccgcatgcgtattggcaaaacatgacatgaataga--ttgggatcgatgagtgatgcagtatacggatattctttgctactgctactgcatgaatcatt |
98 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49786204 |
tccgcatgtgtattggcaaaacatgacctgaatagagattgggatcgatgagtgatgcagtatacggatattctttgctactgctactgcatgaatcatt |
49786303 |
T |
|
| Q |
99 |
ttctagcatcttcctctgttcatctc |
124 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
49786304 |
ttctagca---tcctctgttcatctc |
49786326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University