View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_low_276 (Length: 206)

Name: NF1111_low_276
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_low_276
NF1111_low_276
[»] chr1 (1 HSPs)
chr1 (1-132)||(43947622-43947753)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 43947622 - 43947753
Alignment:
1 attgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagtttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43947622 attgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagtttg 43947721  T
101 tttatttaagtgggattgtatgatattgttgg 132  Q
    |||||||||||||||||||||||||| |||||    
43947722 tttatttaagtgggattgtatgatatggttgg 43947753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University