View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_278 (Length: 206)
Name: NF1111_low_278
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_278 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 1364481 - 1364353
Alignment:
| Q |
1 |
accagaaggaacaagaaggg-gaaaggggatctccttgtcgcagacctctagctaaagtaaatttctcagtgggactaccattcaataaaacagccgcag |
99 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1364481 |
accagaaggaacaagaaaggtgaaaggggatctccctgtcgcagacctctagctaaagtgaatttctcagtgggactaccattcaataaaacagtcgcag |
1364382 |
T |
|
| Q |
100 |
tagcagtcccaacacattctttcattcat |
128 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
1364381 |
tagcagtcccaacacattttttcattcat |
1364353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University