View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_279 (Length: 206)
Name: NF1111_low_279
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_279 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 39771094 - 39770967
Alignment:
| Q |
1 |
tctatttgattatgttaaaaaggaaagaataaatgagaggtacatcaattttgcatgaacacatttattgtatccctaacttcgctcaccttttcattgg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39771094 |
tctatttgagtatgttaaaaaggaaagaataaatgagaggtacatcaattttgcatgaacacatttattgtatccctaacttcgctcaccttttcattgg |
39770995 |
T |
|
| Q |
101 |
attccttgtttcatcacttgatgatatt |
128 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
39770994 |
attccttgtttcatcagttgatgatatt |
39770967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University