View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_low_284 (Length: 204)

Name: NF1111_low_284
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_low_284
NF1111_low_284
[»] chr3 (1 HSPs)
chr3 (1-122)||(46238495-46238616)
[»] chr7 (1 HSPs)
chr7 (1-119)||(3456045-3456163)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 46238495 - 46238616
Alignment:
1 gaagaagatgcatgaaacgatcgaaggacaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46238495 gaagaagatgcatgaaacgatcgaaggacaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac 46238594  T
101 tttcctccctttactcctatga 122  Q
    |||||||  |||||||||||||    
46238595 tttcctctgtttactcctatga 46238616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 3456163 - 3456045
Alignment:
1 gaagaagatgcatgaaacgatcgaaggacaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac 100  Q
    |||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3456163 gaagaagatgcaggaaacaatcgaagggcaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac 3456064  T
101 tttcctccctttactccta 119  Q
    |||| ||  ||||||||||    
3456063 tttcttctgtttactccta 3456045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University