View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_284 (Length: 204)
Name: NF1111_low_284
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_284 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 46238495 - 46238616
Alignment:
| Q |
1 |
gaagaagatgcatgaaacgatcgaaggacaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46238495 |
gaagaagatgcatgaaacgatcgaaggacaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac |
46238594 |
T |
 |
| Q |
101 |
tttcctccctttactcctatga |
122 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
46238595 |
tttcctctgtttactcctatga |
46238616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 3456163 - 3456045
Alignment:
| Q |
1 |
gaagaagatgcatgaaacgatcgaaggacaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac |
100 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3456163 |
gaagaagatgcaggaaacaatcgaagggcaatcgacggttatgaaaaacgttggagctccagttgctgatgtaagttgtctattatgtgaatccctttac |
3456064 |
T |
 |
| Q |
101 |
tttcctccctttactccta |
119 |
Q |
| |
|
|||| || |||||||||| |
|
|
| T |
3456063 |
tttcttctgtttactccta |
3456045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University