View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_286 (Length: 203)
Name: NF1111_low_286
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_286 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 29931973 - 29932066
Alignment:
| Q |
1 |
aaaagcatccctcccaccattggcgggacggctgcaattgtttccagcatcattgcatggcatccgtaccgttcctgcagcagttatatttcag |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29931973 |
aaaagcatccctcccaccattggcgggacggctgcaattgtttccagcatcattgcatggcatccgtaccgttcctgcagcagttatatttcag |
29932066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 29934697 - 29934775
Alignment:
| Q |
1 |
aaaagcatccctcccaccattggcgggacggctgcaattgtttccagcatcattgcatggcatccgtaccgttcctgca |
79 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| || || |||||||||| |
|
|
| T |
29934697 |
aaaagcatccctcccaccattccagggaccgctgctattgtttctagcatcattgcatggcaaccatatcgttcctgca |
29934775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University