View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_37 (Length: 446)
Name: NF1111_low_37
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 102 - 243
Target Start/End: Original strand, 38051239 - 38051380
Alignment:
| Q |
102 |
attgaattggacactccacctagctcatgcaaatgtatgcatgtaaatttcccctccaagctcatgcatgactggacttgggattctttgcaacagattt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051239 |
attgaattggacactccacctagctcatgcaaatgtatgcatgtaaatttcccctccaagctcatgcatgactggacttgggattctttgcaacagattt |
38051338 |
T |
|
| Q |
202 |
tatggtgcactcgactagcttatgattcattttgtgcatgcc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051339 |
tatggtgcactcgactagcttatgattcattttgtgcatgcc |
38051380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 345 - 432
Target Start/End: Original strand, 38051494 - 38051580
Alignment:
| Q |
345 |
gagagagacacgtggtagcatttcctcatgcattccaccgtacatattgcaacacttaccagcttttggtaatgcataccttgtcctc |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38051494 |
gagagagacacgtggtagcatttcctcatgcattccaccgtacatattgcaacacttaccagc-tttggtaatgcataccttgtcctc |
38051580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University