View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_39 (Length: 434)
Name: NF1111_low_39
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 85 - 337
Target Start/End: Original strand, 40103284 - 40103534
Alignment:
| Q |
85 |
gcataggcaacagggaatggtgtggaatgtggcaagatttagttgatccattggtatgcaccttgacattttcggtgatcgaaagaaaataagtgtttcc |
184 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103284 |
gcattggcaacagggaatggtgtggaatgtggcaagatttagttgatccattggtatgcaccttgacattttcggtgatcgaaagaaaataagtgtttcc |
40103383 |
T |
 |
| Q |
185 |
cctgttttaaatcgaaagtgtagagaaaaatgatgaatatgcggaaaaggagaaaaattgttgataaccctaacctgtgaaggaggaggttgttgtcgtt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103384 |
cctgttttaaatcgaaagtgtagagaaaaatgatgaatatgcggaaaaggagaaaaattgttgataaccctaacctgtgaaggaggaggttgttgtcgtt |
40103483 |
T |
 |
| Q |
285 |
gcgagttgcttactgcggcgccgtaaggtggtgttttgccactccattgttgg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40103484 |
gcgagttgcttactgcggcgccgtaaggtggtg--ttgccactccattgttgg |
40103534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University