View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_77 (Length: 382)
Name: NF1111_low_77
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 67 - 284
Target Start/End: Original strand, 9424266 - 9424483
Alignment:
| Q |
67 |
tgaacgagcagaacctgtgtatggtgacaaagtttccatcatctacaatgatcatgttagattttcttggagagaaacctatgaaagatgtctcaagctt |
166 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424266 |
tgaacgagcagccactgtgtatggtgacaaagtttccatcatctacaatgatcatgttagattttcttggagagaaacctatgaaagatgtctcaagctt |
9424365 |
T |
|
| Q |
167 |
gcttctgctttggtcaacttaggaatttctaatggtgatattgtaagttcatttatctcccaatctccttatggttatattatactttcctctcaagcta |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424366 |
gcttctgctttggtcaacttaggaatttctaatggtgatattgtaagttcatttatctcccaatctccttatggttatattatactttcctctcaagcta |
9424465 |
T |
|
| Q |
267 |
actattgtttttcttctc |
284 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
9424466 |
actattgtttttgttctc |
9424483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University