View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_81 (Length: 377)
Name: NF1111_low_81
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 138 - 252
Target Start/End: Complemental strand, 47320175 - 47320055
Alignment:
| Q |
138 |
agatcaaactaggaattgctacatgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgc------cgcttcatcaact |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47320175 |
agatcaaactaggaattgctacatgcaggattgtagtcaaacttgttattgttcgtcatctttctcttcatctttgagtgccgctgccgcttcatcaact |
47320076 |
T |
|
| Q |
232 |
tgaagttcatatttcaactct |
252 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47320075 |
tgaagttcatatttcaactct |
47320055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 112 - 154
Target Start/End: Complemental strand, 47320222 - 47320180
Alignment:
| Q |
112 |
tactgtgaaattgacacataacagatagatcaaactaggaatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47320222 |
tactgtgaaattgacacataacagatagatcaaactaggaatt |
47320180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 136 - 201
Target Start/End: Complemental strand, 47316662 - 47316597
Alignment:
| Q |
136 |
atagatcaaactaggaattgctacatgcaggattgtagtcaaacttgttattgttcgtcatctttc |
201 |
Q |
| |
|
||||||||||||||||||| ||| | ||| ||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
47316662 |
atagatcaaactaggaatttctatacgcacgattgtaatcaaacttattattgttcatcatctttc |
47316597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 241
Target Start/End: Complemental strand, 47311332 - 47311272
Alignment:
| Q |
181 |
tgttattgttcgtcatctttctcttcatctttgagtgccgcttcatcaacttgaagttcat |
241 |
Q |
| |
|
||||||| ||| |||| ||||| ||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
47311332 |
tgttattcttcatcatttttctgctcatctttgagtgccactccatcaccttgaagttcat |
47311272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University