View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_13 (Length: 498)
Name: NF11121_high_13
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 9 - 405
Target Start/End: Original strand, 27034671 - 27035065
Alignment:
| Q |
9 |
agcagagacacaggcattggcatcgaacacgacactgacacacgtcagacactagatacatcttctactatagagaaaatttatctttttgtaattgtca |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034671 |
agcacagacacaggcattggcatcgaacacgac--tgacacacgtcagacaccagatacatcttctactatagagaaaatttatctttttgtaattgtca |
27034768 |
T |
 |
| Q |
109 |
atctttcatatcttgtgtcataagtaatagtagtattttgaattaagaggttaggttcaaatgattaatgagttccaacgaaagtcaaatcgatcagagt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034769 |
atctttcatatcttgtgtcataagtaatagtagtattctgaattaagaggttaggttcaaatgattaatgagttccaacgaaagtcaaatcgatcagagt |
27034868 |
T |
 |
| Q |
209 |
acccaagttcaagctttggttggaacaataagttgtcatactttattcacctctttgccaaactcgggatttataggaagtcaggaaccatttcctcttg |
308 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27034869 |
acccgagttcaagctttggttggaacaataagttgtcgtactttattcacctctttgccgaactcaggatttataggaagtcaggaaccatttcctcttg |
27034968 |
T |
 |
| Q |
309 |
aaattggaaggttaagacaaagaaaagtgactttctttggatacggcttgtgaattttcttcttgagttaagtgctgatttagcaatttattccttt |
405 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
27034969 |
aaattggagggttaagacaaagaaaagtgaccttctttggatacggcttgtgaattttcttcttgagttaagtactgttttagcaatttattccttt |
27035065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University