View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_62 (Length: 258)
Name: NF11121_high_62
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 5 - 245
Target Start/End: Original strand, 33061532 - 33061779
Alignment:
| Q |
5 |
aagaatgcatatatactgctcttgaacaaataaccattatgtctacaatatgtatcatgtgccatgagttcacaaatcacaatcatgacaaagaagcaaa |
104 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33061532 |
aagaatgcatatatactgctgttgaacaaataaccattatgtctacaatatgtatcatgtgccattagttcacaaatcacaatcatgacaaagaagcaaa |
33061631 |
T |
 |
| Q |
105 |
atcaacatccaagatata-------ctaatctctaatatgatcaaatccaagaagtttgatggacttgactagataaatgcgtcagatcggaccggttca |
197 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| || |
|
|
| T |
33061632 |
atcaacatccaagatatactaatctctaatctctaatatgatcaaatccaagaagtttgatggacttgactagataaatgagttagatcggaccggtcca |
33061731 |
T |
 |
| Q |
198 |
tttatctttggactataaatttgtaaagagatttacttttcccaccct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33061732 |
tttatctttggactataaatttgtaaagagatttactttttccaccct |
33061779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University