View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_65 (Length: 254)
Name: NF11121_high_65
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_65 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 93309 - 93065
Alignment:
| Q |
1 |
cttgcgctagagcgagacactggattcgtgatcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggtaggtaccgnnnnnnnnna |
100 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
93309 |
cttgtgctagagcaagacactggattcgtgttcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggtaggtaccgttttttttta |
93210 |
T |
 |
| Q |
101 |
ttcaatcaatataaaaatgtctgcaaactaacatataatatgtttctaatttgaataaatcttttacctatagatacttggtatttttgattggagtgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
93209 |
ttcaatcaatataaaaatgtctgcaaactaacatataatatgtttctaatttgaatatatcttttacctatagatacttggtctttttgattggagtgga |
93110 |
T |
 |
| Q |
201 |
agcaacccaatgccacctaaattttggctccttccttcatctctc |
245 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
93109 |
agcaacccaatgccacctgaattttggctccttccttcatttctc |
93065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 162246 - 162334
Alignment:
| Q |
1 |
cttgcgctagagcgagacactggattcgtgatcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggtaggtacc |
89 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||| ||||||||||||| ||||||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
162246 |
cttgtgctagagccagaaactggattcgtgatcacggtggtgtaacacgtataccttcatgggggaaaacttggctttcggtagctacc |
162334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 139 - 240
Target Start/End: Original strand, 103195 - 103296
Alignment:
| Q |
139 |
tatgtttctaatttgaataaatcttttacctatagatacttggtatttttgattggagtggaagcaacccaatgccacctaaattttggctccttccttc |
238 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||||||||||||||| | ||||||||| ||||||||||||||||| ||| | |||||| |||||||||| |
|
|
| T |
103195 |
tatgttactaatttgaatgtatcatttacctatagatacttggtctctttgattggttgggaagcaacccaatgccccctgagttttggatccttccttc |
103294 |
T |
 |
| Q |
239 |
at |
240 |
Q |
| |
|
|| |
|
|
| T |
103295 |
at |
103296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 103066 - 103148
Alignment:
| Q |
1 |
cttgcgctagagcgagacactggattcgtgatcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggta |
83 |
Q |
| |
|
|||| |||||||| ||| |||||||||| | || |||||||| ||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
103066 |
cttgtgctagagccagaaactggattcgggcacacggtggtgtcacatatataccttcatggggaaaaacttggctttcggta |
103148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 139 - 240
Target Start/End: Original strand, 162463 - 162567
Alignment:
| Q |
139 |
tatgtttctaatttgaataa---atcttttacctatagatacttggtatttttgattggagtggaagcaacccaatgccacctaaattttggctccttcc |
235 |
Q |
| |
|
|||||| || |||||||||| ||| ||||| |||||||||||||| | | ||||||| ||||||||||||||||| ||| | |||||| ||||||| |
|
|
| T |
162463 |
tatgttacttatttgaataatgtatcctttacgtatagatacttggtgtatatgattggtcgggaagcaacccaatgccccctgagttttggatccttcc |
162562 |
T |
 |
| Q |
236 |
ttcat |
240 |
Q |
| |
|
||||| |
|
|
| T |
162563 |
ttcat |
162567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 83
Target Start/End: Original strand, 13051974 - 13052048
Alignment:
| Q |
9 |
agagcgagacactggattcgtgatcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggta |
83 |
Q |
| |
|
||||| ||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13051974 |
agagcaagaaactggattcgtgatcacggtggtgtaacgcatataccttcatggggaaaaacttggctttcggta |
13052048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 12138177 - 12138115
Alignment:
| Q |
21 |
tggattcgtgatcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggta |
83 |
Q |
| |
|
||||||| ||||||||||||||| ||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
12138177 |
tggattcatgatcatggtggtgtgacacagataccttcatggggaaaaacttggctttcggta |
12138115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 12138030 - 12137987
Alignment:
| Q |
166 |
acctatagatacttggtatttttgattggagtggaagcaaccca |
209 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
12138030 |
acctatagatacttggtgtatttgattggagtggaaccaaccca |
12137987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 5670912 - 5670850
Alignment:
| Q |
21 |
tggattcgtgatcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggta |
83 |
Q |
| |
|
||||||| ||||||||||||||| ||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
5670912 |
tggattcatgatcatggtggtgtgacatacgtaccttcatggggaaaaatttggctttcggta |
5670850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 240
Target Start/End: Complemental strand, 5670754 - 5670686
Alignment:
| Q |
172 |
agatacttggtatttttgattggagtggaagcaacccaatgccacctaaattttggctccttccttcat |
240 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||||||||||||||| ||| | |||||| | ||||| |||| |
|
|
| T |
5670754 |
agatacttggtatctttgattggcgtgcaagcaacccaatgccccctgagttttggatgcttccctcat |
5670686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 240
Target Start/End: Complemental strand, 5692502 - 5692434
Alignment:
| Q |
172 |
agatacttggtatttttgattggagtggaagcaacccaatgccacctaaattttggctccttccttcat |
240 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||||||||||||||| ||| | |||||| | ||||| |||| |
|
|
| T |
5692502 |
agatacttggtatctttgattggcgtgcaagcaacccaatgcctcctgagttttggatgcttccctcat |
5692434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 240
Target Start/End: Complemental strand, 5722842 - 5722774
Alignment:
| Q |
172 |
agatacttggtatttttgattggagtggaagcaacccaatgccacctaaattttggctccttccttcat |
240 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||||||||||||||| ||| | |||||| | ||||| |||| |
|
|
| T |
5722842 |
agatacttggtatctttgattggcgtgcaagcaacccaatgcctcctgagttttggatgcttccctcat |
5722774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 5692658 - 5692596
Alignment:
| Q |
21 |
tggattcgtgatcatggtggtgtaacacatataccttcatggggaaaaacatggctttcggta |
83 |
Q |
| |
|
||||||| ||||||||||||||| ||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
5692658 |
tggattcatgatcatggtggtgtgacatacgtaccttcatggggaaaattttggctttcggta |
5692596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University