View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_75 (Length: 241)
Name: NF11121_high_75
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_75 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 39810005 - 39810223
Alignment:
| Q |
1 |
ccttcaaagagtttcgcgagtgtttatgttagtagataagctagctagctcaaataagttaatctaaacataccttat---tattaattgatatctttcc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
39810005 |
ccttcaaagagtttcgcgagtgtttatgttagtagataagctagctagctcaaataagttaatctattcataccttattattattaattgatatctttcc |
39810104 |
T |
|
| Q |
98 |
taatattactattgtgaaagctatgatcatatgtatgtaaatgcaatgtttgatcaatgatcatggccttggcttttatacagtttgcatggattggtac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39810105 |
taatattactattgtgaaagctatgatcatatgtatgtaaatgcaatgtt-------tgatcatggccttggcttttatacagtttgcatggattggtac |
39810197 |
T |
|
| Q |
198 |
gaggagaaaacatggagcttggtaga |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39810198 |
gaggagaaaacatggagcttggtaga |
39810223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 220
Target Start/End: Original strand, 15797561 - 15797604
Alignment:
| Q |
177 |
acagtttgcatggattggtacgaggagaaaacatggagcttggt |
220 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
15797561 |
acagtttgcatggattggttaggggagaaaacatggagcttggt |
15797604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University