View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11121_high_78 (Length: 239)

Name: NF11121_high_78
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11121_high_78
NF11121_high_78
[»] chr2 (1 HSPs)
chr2 (1-62)||(44823050-44823111)
[»] chr4 (1 HSPs)
chr4 (6-54)||(2205214-2205262)


Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 44823111 - 44823050
Alignment:
1 aacaaaccttgtaaaccaacgaacatgacaacacttgtttttcctttcttgggaacgaaaga 62  Q
    |||||||||||||||||||| ||||| ||||||||||||||| || | |||||||| |||||    
44823111 aacaaaccttgtaaaccaacaaacataacaacacttgttttttctcttttgggaacaaaaga 44823050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 6 - 54
Target Start/End: Original strand, 2205214 - 2205262
Alignment:
6 accttgtaaaccaacgaacatgacaacacttgtttttcctttcttggga 54  Q
    |||||||||||||||||||||||||||||| | ||||||||| ||||||    
2205214 accttgtaaaccaacgaacatgacaacactagcttttccttttttggga 2205262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University