View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_78 (Length: 239)
Name: NF11121_high_78
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 44823111 - 44823050
Alignment:
| Q |
1 |
aacaaaccttgtaaaccaacgaacatgacaacacttgtttttcctttcttgggaacgaaaga |
62 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||| || | |||||||| ||||| |
|
|
| T |
44823111 |
aacaaaccttgtaaaccaacaaacataacaacacttgttttttctcttttgggaacaaaaga |
44823050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 6 - 54
Target Start/End: Original strand, 2205214 - 2205262
Alignment:
| Q |
6 |
accttgtaaaccaacgaacatgacaacacttgtttttcctttcttggga |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
2205214 |
accttgtaaaccaacgaacatgacaacactagcttttccttttttggga |
2205262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University