View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_80 (Length: 239)
Name: NF11121_high_80
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_80 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 28955427 - 28955649
Alignment:
| Q |
1 |
cattccctccaaactctcaaacaaaaccttaatgatatatcgaggcataagtctctaaacaatacccacttatttattatatctttccataaatttctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28955427 |
cattccctccaaactctcaaacaaaaccttaatgatatgtcgaggcctaagtctctaaacaatacccacttatttattatatctttccataaatttctca |
28955526 |
T |
|
| Q |
101 |
aacaatgcttgtttatacacacctatttaatcttgctttttctatgccgccctataaattcctagacctgcttggaagcatatattaatagattgaatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28955527 |
aacaatgcttgtttatacacacctatttaatcttgctttttctatgccgccctataaattcctagacctgcttggaagcatatattaatagattgaatag |
28955626 |
T |
|
| Q |
201 |
aacattctaatgcgtaatgaaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28955627 |
aacattctaatgcgtaatgaaat |
28955649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 100 - 184
Target Start/End: Original strand, 28993655 - 28993740
Alignment:
| Q |
100 |
aaacaatgcttgtttatacacacctatttaatctt-gctttttctatgccgccctataaattcctagacctgcttggaagcatata |
184 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
28993655 |
aaacaatgcttgtttatagacacctatttaatcttcgctttttctatgcagccctataaattcctagaccagctaggaagcatata |
28993740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University