View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_87 (Length: 234)
Name: NF11121_high_87
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_87 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 7 - 215
Target Start/End: Complemental strand, 38930695 - 38930481
Alignment:
| Q |
7 |
tttgggcatggcctcaatcacataataggtctctcgagcatcttttgaaaagatgtatactattacgtccggtagttttcattgatttgaaataaaga-- |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930695 |
tttgggcatggcctcaatcacataataggtctctcgagcatcttttgaaaagatgtac-ctattacgtccggtagttttcattgatttgaaataaagaaa |
38930597 |
T |
|
| Q |
105 |
------gttgaagattttcgatttaaatctaacaaaaataaaaataatactagtataaccattaattattgctaacatctaacatttgccactaaaaaca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38930596 |
taaagagttgaagattttcgatttaaatctaacaaaaataaaaataaaaataatataaccattaattattgct-acatctaacatttgccactaaaaaca |
38930498 |
T |
|
| Q |
199 |
tcatatagttttcagac |
215 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38930497 |
tcatatagttttcagac |
38930481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University