View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_high_95 (Length: 214)
Name: NF11121_high_95
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_high_95 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 38326801 - 38326619
Alignment:
| Q |
14 |
atgaaactacagttaaatacaatagaaggttacaaaacattaacattgcaacaagattatcatattaaaagttctataattataaaacaattcaattaga |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326801 |
atgaaactacacttaaatacaatagaaggttacaaaacattaacattgcaacaagattatcatattaaaagttctataattataaaacaattcaattaga |
38326702 |
T |
|
| Q |
114 |
caaactataaagataatatgatagagcaactagctactcaaactaaacattggttgcaacaagttggaaccattggctctgtg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326701 |
caaactataaagataatatgatagagcaactagttactcaaactaaacattggttgcaacaagttggaaccattggctctgtg |
38326619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 10766522 - 10766477
Alignment:
| Q |
149 |
actcaaactaaacattggttgcaacaagttggaaccattggctctg |
194 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
10766522 |
actcaaactaaacattggtggcaacaagttgaaaccattggctctg |
10766477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University