View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11121_high_96 (Length: 208)

Name: NF11121_high_96
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11121_high_96
NF11121_high_96
[»] chr4 (2 HSPs)
chr4 (15-193)||(7418943-7419121)
chr4 (18-191)||(13031703-13031875)
[»] scaffold0105 (4 HSPs)
scaffold0105 (27-117)||(3525-3615)
scaffold0105 (27-117)||(15672-15762)
scaffold0105 (27-117)||(35477-35567)
scaffold0105 (27-117)||(49077-49167)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 7418943 - 7419121
Alignment:
15 atgaaggagattgggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatact 114  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
7418943 atgaaggagattgggagtagcctttcgggcatgtggagatcaacatgtatttcttggaggttctactattcatgatggaagcatgatgaaaattaatact 7419042  T
115 tgggttttatatgatggtgcaccatagtggaacaggcttacgagaaagcaattaggaagctttgtgcataattgcactg 193  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7419043 tgggttttgtatgatggtgcaccatagtggaacaggcttacgagaaagcaattaggaagttttgtgcataattgcactg 7419121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 13031875 - 13031703
Alignment:
18 aaggagattgggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg 117  Q
    |||||||||||||||||||||| |||||| |||| |||| | ||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||    
13031875 aaggagattgggagtagccttttgggcatatggatatcaacgtgtatttcttggaggttctactcttcatgatggaagcatgatgaaaattaatatttgg 13031776  T
118 gttttatatgatggtgcaccatagtggaacaggcttacgagaaagcaattaggaagctttgtgcataattgcac 191  Q
    ||| |||||||||| ||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||    
13031775 gttctatatgatggcgcaccatagtggaac-ggcttgcgagaaagcaattagcaagctttgtgcataattgcac 13031703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 31; Significance: 0.00000002; HSPs: 4)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Complemental strand, 3615 - 3525
Alignment:
27 gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg 117  Q
    |||| |||||||||| ||||| |||||||| |   |||||||||||||| ||| |||||||| |||||  |||||| |||| ||| |||||    
3615 gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg 3525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Complemental strand, 15762 - 15672
Alignment:
27 gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg 117  Q
    |||| |||||||||| ||||| |||||||| |   |||||||||||||| ||| |||||||| |||||  |||||| |||| ||| |||||    
15762 gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg 15672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Original strand, 35477 - 35567
Alignment:
27 gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg 117  Q
    |||| |||||||||| ||||| |||||||| |   |||||||||||||| ||| |||||||| |||||  |||||| |||| ||| |||||    
35477 gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg 35567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Original strand, 49077 - 49167
Alignment:
27 gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg 117  Q
    |||| |||||||||| ||||| |||||||| |   |||||||||||||| ||| |||||||| |||||  |||||| |||| ||| |||||    
49077 gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg 49167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University