View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_52 (Length: 294)
Name: NF11121_low_52
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 49 - 278
Target Start/End: Complemental strand, 6633897 - 6633668
Alignment:
| Q |
49 |
gtgcatcatgcatggaactttcttcaaagttgtcatgtatcatatgaactttgattatgaatattaatttggttttgtatgtgtgcagaggatgtggttg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6633897 |
gtgcatcatgcatggaactttcttcaaagttgtcatgtatcatatgaactttgattatgaatattaatttggttttgtatgtgtgcagaggatgtggttg |
6633798 |
T |
 |
| Q |
149 |
cacaggaagagacttcggctaaggaagaagttgtcgaaaacacaaatgtttcagcctctgaagctgaagctgaagctggaggtgaaaataattaaggtga |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6633797 |
cacaggaagagacttcggctaaggaagaagttgtcgaaaacacaaatgtttcagcctctgaagctgaagctgaagctggaggtgaaaataattaaggtga |
6633698 |
T |
 |
| Q |
249 |
tttgaaaactggggagaggaagtatatata |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6633697 |
tttgaaaactggggagaggaagtatatata |
6633668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University