View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_53 (Length: 290)
Name: NF11121_low_53
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 27790742 - 27791013
Alignment:
| Q |
1 |
cagttcatcagtggtggggttaaataactatttggttgattaattgcttttggcagaagttattaatttattattgcatgagattctcaacaaagtgtac |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27790742 |
cagttcatcagtggtggggttaattaactatttggttgattaattacttttggcagaagtaattaatttattattgcatgagattctcaacaaagtgtac |
27790841 |
T |
|
| Q |
101 |
ctaatcacaatctaatctattnnnnnnngttcacgagaccatgcatttttatagagatggacattgttgtgcccatgcaggattggtgtttgagagagag |
200 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
27790842 |
ctaatcacaatctaatctattaaaaaaagttcatgagaccatgcatttttatagagatggacattgttgtgctcatgcaggattggtgttt--gagagag |
27790939 |
T |
|
| Q |
201 |
tgatgtggatatggaaacaaagacttcccagatttaaaggcttgagagagttagagagatgggagtggatctag |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27790940 |
tgatgtggatatggaaacaaagacttcccagatttaaaggcttgagagagttagagagatgggagtggatctag |
27791013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University