View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_69 (Length: 251)
Name: NF11121_low_69
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 2627221 - 2626994
Alignment:
| Q |
18 |
ctgtgcctcatgacaatcaataatggcnnnnnnnnnnggcttaggagacaattggaagcaacttgcacatattttgtactgcttatgctaattggttttg |
117 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627221 |
ctgtgcctcatgacaatcaatgatggcaaaaaaaaatggcttaggagacaattggaagcaacttgcacatattttgtactgcttatgctaattggttttg |
2627122 |
T |
 |
| Q |
118 |
ttctcatttctcgttaaattggcatgtgaaagcacgttttatggttggatactatattactgataatgtctaaatttggatgnnnnnnnnnnnnngataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2627121 |
ttctcatttctcgttaaattggcatgtgaaagcacgttttatggttggatactatattactgataatgtctaaatttggatgaaaaaatgaaaaagataa |
2627022 |
T |
 |
| Q |
218 |
ccactgatatatgctagctctctgctcc |
245 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
2627021 |
ccactgatatatgctagctctcttctcc |
2626994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University