View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11121_low_77 (Length: 240)

Name: NF11121_low_77
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11121_low_77
NF11121_low_77
[»] chr7 (1 HSPs)
chr7 (42-210)||(38124618-38124789)


Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 42 - 210
Target Start/End: Complemental strand, 38124789 - 38124618
Alignment:
42 gggtggattattaagtattagaaattgcagataaaggcctcgacctcgatagagagctcacctcacctcacctcacctcaccgcctgcactttattcccc 141  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||| ||||||||||||||| | ||||||||||||||||||    
38124789 gggtggattattaagtattagaaattgcagataaaggcctcgacctcgatagagagcgaaccttacctcacctcacctccctgcctgcactttattcccc 38124690  T
142 ctttcaaattcgctgctttgcattcttgttgtactctttagtcttt---ttttactcacaacgaggtttttt 210  Q
    |||||||||||||||||||||||||||| |||||||||||||||||   |||||||||||||||||||||||    
38124689 ctttcaaattcgctgctttgcattcttgctgtactctttagtcttttttttttactcacaacgaggtttttt 38124618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University