View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_77 (Length: 240)
Name: NF11121_low_77
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 42 - 210
Target Start/End: Complemental strand, 38124789 - 38124618
Alignment:
| Q |
42 |
gggtggattattaagtattagaaattgcagataaaggcctcgacctcgatagagagctcacctcacctcacctcacctcaccgcctgcactttattcccc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
38124789 |
gggtggattattaagtattagaaattgcagataaaggcctcgacctcgatagagagcgaaccttacctcacctcacctccctgcctgcactttattcccc |
38124690 |
T |
 |
| Q |
142 |
ctttcaaattcgctgctttgcattcttgttgtactctttagtcttt---ttttactcacaacgaggtttttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38124689 |
ctttcaaattcgctgctttgcattcttgctgtactctttagtcttttttttttactcacaacgaggtttttt |
38124618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University