View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_8 (Length: 535)
Name: NF11121_low_8
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_8 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0004 (Bit Score: 480; Significance: 0; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 480; E-Value: 0
Query Start/End: Original strand, 1 - 517
Target Start/End: Original strand, 374119 - 374635
Alignment:
| Q |
1 |
cagtagcaataaactcattggaataaggttccttgagtatgtaaaaggaagtcctgtttcccacaaaacccaccaagcaattgttctgattgtaacattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374119 |
cagtagcaataaactcattggaataaggttccttgagtatgtaaaaggaagtcctgtttcccacaaaacccaccaagcaattgttctgattgtaacattt |
374218 |
T |
 |
| Q |
101 |
ctagcttatgctagttatcacgcaactagaaaaaccactagtattgtaaagagtgttcttgatccccaatcatcttcaacaaatttaggcttcaatttct |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374219 |
ctagcttatgctagttatcacgccactagaaaaaccactagtattgtgaagagtgtgcttgatccccaatcatcttcaacaaatttaggcttcaatttct |
374318 |
T |
 |
| Q |
201 |
ttccttcgagtacgagggttacaaaactttcttggaaacttggagatggctgggctccatttaatggatccgacgggacatcccttcttggccaattgga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374319 |
ttccttcgagtacgagggttacaaaactttcttggaaacttggagatggctgggctccatttaatggatccgacgggacatcccttcttggccaattgga |
374418 |
T |
 |
| Q |
301 |
tgttgcttttctcgcagtttatgcatttgggatgtacttttctggacattttggtgacaggtgtaatttgaggannnnnnnaactattgggatggttgga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
374419 |
tgttgcttttctcgcagtttatgcatttgggatgtacttttctggacattttggtgacaggtgtaatttgaggatttttttaactattgggatggttgga |
374518 |
T |
 |
| Q |
401 |
actggtgttttcacttcactctttggtgtagggttttggggaaacaatcacaatttctactattatttagtcattcaaatgatttctggtttgtttcaat |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
374519 |
actggtgttttcacttcactctttggtgtagggttttggggaaacaatcacaatttctactattatttagtcattcaaatgattgctggtttgtttcaat |
374618 |
T |
 |
| Q |
501 |
ccactggatggccatcc |
517 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
374619 |
ccactggatggccatcc |
374635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University