View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_80 (Length: 239)
Name: NF11121_low_80
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5763198 - 5763418
Alignment:
| Q |
1 |
aaatgaatcttgatatgaaaatgaatgagtcagtatttgaataaatacccttgtttattgccattcaacttcccactttactctaacccacaatatggca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5763198 |
aaatgaatcttgatatgaaaatgaatgagtcagtatttgaataaatacccttgtttattgccattcaacttcccactttactctaactcacaatatggca |
5763297 |
T |
 |
| Q |
101 |
cataacactgaggttgatgatgaacatgaaagagataacaaagccaaccagaaagtttcattccacaaactcttcacttttgctgatagtcttgatgtaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5763298 |
cataacactgaggt---tgatgaacatgaaagagataacaaagccaaccagaaagtttcattccacaaactctttacttttgctgatagtcttgatgtaa |
5763394 |
T |
 |
| Q |
201 |
cattgatgatcattggcaccatct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5763395 |
cattgatgatcattggcaccatct |
5763418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 131 - 224
Target Start/End: Complemental strand, 5835375 - 5835282
Alignment:
| Q |
131 |
agagataacaaagccaaccagaaagtttcattccacaaactcttcacttttgctgatagtcttgatgtaacattgatgatcattggcaccatct |
224 |
Q |
| |
|
|||||||||||| | || || |||||| ||||| ||| || |||| |||||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5835375 |
agagataacaaaacaaaacaaaaagttccattctacatgcttttcaattttgctgatcatcttgatgtaacgttgatgatcattggcactatct |
5835282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 136 - 219
Target Start/End: Complemental strand, 29332842 - 29332759
Alignment:
| Q |
136 |
taacaaagccaaccagaaagtttcattccacaaactcttcacttttgctgatagtcttgatgtaacattgatgatcattggcac |
219 |
Q |
| |
|
||||||||||||||| | |||| ||||| |||| ||||| | |||||||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
29332842 |
taacaaagccaaccaaatagttccattctacaagctctttagttttgctgatcgtcttgacgtaactttgatgatcattggcac |
29332759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University