View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_83 (Length: 239)
Name: NF11121_low_83
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 18049210 - 18049398
Alignment:
| Q |
1 |
tgattgcctcagattaattctaatgctgaaaataagaaaaatttaagcaagtgttataattttatttgggtatannnnnnnag--tattataaattaata |
98 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
18049210 |
tgattgcctcaggtttattctaatgctgaaaataacaaaaatttaagcaagtgttataattttatttgggtatatagggggagattattataaattaata |
18049309 |
T |
 |
| Q |
99 |
tgatatcagaagtttaataggaattttacttacttcttttgaacatgaacatattcatcagtttcatccaatatgtctcccttgtaaag |
187 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18049310 |
tgataccggaagtttaataggaattttacttacttcttttgaacatgaacatattcatcagtttcgtccaatatgtctcccttgtaaag |
18049398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University