View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_85 (Length: 238)
Name: NF11121_low_85
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 29 - 174
Target Start/End: Original strand, 212281 - 212432
Alignment:
| Q |
29 |
tactatctcttttgtatgatcaggaggaggaagtatggctttcataaaatgctttgaatctttctccgc------cgccggtgacgttgacggaacactt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
212281 |
tactatctcttttgtatgatcaggaggaggaagtatggctttcataaaatgctttgaatctttctccgccgccgccgccggtgacgttgacggaacacgt |
212380 |
T |
|
| Q |
123 |
cttctcgggcgaggcttcattgtttctttgttgcatatgtgatatactggaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
212381 |
cttctcgggcgaggcttcattgtttctttgttgcatatgtgatatactggaa |
212432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 29 - 107
Target Start/End: Original strand, 199181 - 199259
Alignment:
| Q |
29 |
tactatctcttttgtatgatcaggaggaggaagtatggctttcataaaatgctttgaatctttctccgccgccggtgac |
107 |
Q |
| |
|
|||||||||||| || ||||||||||| || ||||||||||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
199181 |
tactatctctttggtgtgatcaggagggggtagtatggctttcataaaatgcttcgatgctttctccggcgccggtgac |
199259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 105
Target Start/End: Original strand, 223577 - 223625
Alignment:
| Q |
57 |
ggaagtatggctttcataaaatgctttgaatctttctccgccgccggtg |
105 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
223577 |
ggaaggatggctttcataaaatgtttagaatctttctccggcgccggtg |
223625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 105
Target Start/End: Original strand, 218369 - 218417
Alignment:
| Q |
57 |
ggaagtatggctttcataaaatgctttgaatctttctccgccgccggtg |
105 |
Q |
| |
|
||||| ||||||||||||||||| || ||||| ||||||||| |||||| |
|
|
| T |
218369 |
ggaaggatggctttcataaaatgtttagaatccttctccgccaccggtg |
218417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University