View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11121_low_85 (Length: 238)

Name: NF11121_low_85
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11121_low_85
NF11121_low_85
[»] chr3 (4 HSPs)
chr3 (29-174)||(212281-212432)
chr3 (29-107)||(199181-199259)
chr3 (57-105)||(223577-223625)
chr3 (57-105)||(218369-218417)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 29 - 174
Target Start/End: Original strand, 212281 - 212432
Alignment:
29 tactatctcttttgtatgatcaggaggaggaagtatggctttcataaaatgctttgaatctttctccgc------cgccggtgacgttgacggaacactt 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||| |    
212281 tactatctcttttgtatgatcaggaggaggaagtatggctttcataaaatgctttgaatctttctccgccgccgccgccggtgacgttgacggaacacgt 212380  T
123 cttctcgggcgaggcttcattgtttctttgttgcatatgtgatatactggaa 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
212381 cttctcgggcgaggcttcattgtttctttgttgcatatgtgatatactggaa 212432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 29 - 107
Target Start/End: Original strand, 199181 - 199259
Alignment:
29 tactatctcttttgtatgatcaggaggaggaagtatggctttcataaaatgctttgaatctttctccgccgccggtgac 107  Q
    |||||||||||| || ||||||||||| || ||||||||||||||||||||||| ||  ||||||||| ||||||||||    
199181 tactatctctttggtgtgatcaggagggggtagtatggctttcataaaatgcttcgatgctttctccggcgccggtgac 199259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 105
Target Start/End: Original strand, 223577 - 223625
Alignment:
57 ggaagtatggctttcataaaatgctttgaatctttctccgccgccggtg 105  Q
    ||||| ||||||||||||||||| || ||||||||||||| ||||||||    
223577 ggaaggatggctttcataaaatgtttagaatctttctccggcgccggtg 223625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 105
Target Start/End: Original strand, 218369 - 218417
Alignment:
57 ggaagtatggctttcataaaatgctttgaatctttctccgccgccggtg 105  Q
    ||||| ||||||||||||||||| || ||||| ||||||||| ||||||    
218369 ggaaggatggctttcataaaatgtttagaatccttctccgccaccggtg 218417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University