View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_88 (Length: 236)
Name: NF11121_low_88
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_88 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 44144848 - 44144613
Alignment:
| Q |
1 |
ctaatccccggagccttttaactttgtcttgttttccttttagcagtaacgtttctttgcattgatgatgtcatggaagtaaatatttttgttgcaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44144848 |
ctaatccccggagccttttaactttgtcttgttttccttttagcagttacgtttctttgcactgatgatgtcgtggaagtaaatatttttgttgcaaaaa |
44144749 |
T |
|
| Q |
101 |
ttagataataacgcctcgttttgtaaggctatgatgtcaaattccagtatgtacaaaactttatctggtttaatccatgtaaggagagaaacttcttgtt |
200 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44144748 |
ttagataataacgccttgtttcctaaggctatgatgtcgaattccagtatgtacaaaactttatctggtttaatccatctaaggagagaaacttcttgtt |
44144649 |
T |
|
| Q |
201 |
aaattacaggccaagtaaaatttcttgcaaagcttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44144648 |
aaattacaggccaagtaaaatttcttgcaaagcttc |
44144613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University