View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11121_low_89 (Length: 234)

Name: NF11121_low_89
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11121_low_89
NF11121_low_89
[»] chr7 (1 HSPs)
chr7 (7-215)||(38930481-38930695)


Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 7 - 215
Target Start/End: Complemental strand, 38930695 - 38930481
Alignment:
7 tttgggcatggcctcaatcacataataggtctctcgagcatcttttgaaaagatgtatactattacgtccggtagttttcattgatttgaaataaaga-- 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||      
38930695 tttgggcatggcctcaatcacataataggtctctcgagcatcttttgaaaagatgtac-ctattacgtccggtagttttcattgatttgaaataaagaaa 38930597  T
105 ------gttgaagattttcgatttaaatctaacaaaaataaaaataatactagtataaccattaattattgctaacatctaacatttgccactaaaaaca 198  Q
          ||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||| ||||||||||||||||||||||||||    
38930596 taaagagttgaagattttcgatttaaatctaacaaaaataaaaataaaaataatataaccattaattattgct-acatctaacatttgccactaaaaaca 38930498  T
199 tcatatagttttcagac 215  Q
    |||||||||||||||||    
38930497 tcatatagttttcagac 38930481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University