View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_91 (Length: 230)
Name: NF11121_low_91
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 35288537 - 35288732
Alignment:
| Q |
18 |
agagttttttgctctttgttgttatttgtcattttaggtgaatatgctacgagagaggaacacgagttatggcaccatcaagtttgttgatataggctca |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35288537 |
agagtcttttgctctttgttgttatttgtcattttaggtgaatatgctacgagagaggaacacgagttatggcaccatcaagtttgttgatataggctca |
35288636 |
T |
 |
| Q |
118 |
gatgattactctcccgacgagaatcagggcctcgactatcaaactgttagtcccttctctatggcctcgaagctgatttatttatttttggtttca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35288637 |
gatgattactctcccgacgagaatcagggcctcgactatcaaactgttagtcccttctctatggcctcgaagctgatttatttatttttgctttca |
35288732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University