View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_92 (Length: 229)
Name: NF11121_low_92
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_92 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 14526900 - 14527106
Alignment:
| Q |
1 |
gataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcgactatggagaagattagcgagcagatgcgcagtaccggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14526900 |
gataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcaactatggagaagattagcgagcagatgcgcagtaccggc |
14526999 |
T |
|
| Q |
101 |
ttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggagatctttcattacttgactgtgtgttgtgttatgctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527000 |
ttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggatatctttcattacttgactgtgtgttgtgttatgctg |
14527099 |
T |
|
| Q |
201 |
aggcgcg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
14527100 |
aggcgcg |
14527106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University