View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11121_low_98 (Length: 208)
Name: NF11121_low_98
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11121_low_98 |
 |  |
|
| [»] scaffold0105 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 7418943 - 7419121
Alignment:
| Q |
15 |
atgaaggagattgggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7418943 |
atgaaggagattgggagtagcctttcgggcatgtggagatcaacatgtatttcttggaggttctactattcatgatggaagcatgatgaaaattaatact |
7419042 |
T |
 |
| Q |
115 |
tgggttttatatgatggtgcaccatagtggaacaggcttacgagaaagcaattaggaagctttgtgcataattgcactg |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7419043 |
tgggttttgtatgatggtgcaccatagtggaacaggcttacgagaaagcaattaggaagttttgtgcataattgcactg |
7419121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 13031875 - 13031703
Alignment:
| Q |
18 |
aaggagattgggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| |||| | ||||||||||||||||||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
13031875 |
aaggagattgggagtagccttttgggcatatggatatcaacgtgtatttcttggaggttctactcttcatgatggaagcatgatgaaaattaatatttgg |
13031776 |
T |
 |
| Q |
118 |
gttttatatgatggtgcaccatagtggaacaggcttacgagaaagcaattaggaagctttgtgcataattgcac |
191 |
Q |
| |
|
||| |||||||||| ||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13031775 |
gttctatatgatggcgcaccatagtggaac-ggcttgcgagaaagcaattagcaagctttgtgcataattgcac |
13031703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 31; Significance: 0.00000002; HSPs: 4)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Complemental strand, 3615 - 3525
Alignment:
| Q |
27 |
gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg |
117 |
Q |
| |
|
|||| |||||||||| ||||| |||||||| | |||||||||||||| ||| |||||||| ||||| |||||| |||| ||| ||||| |
|
|
| T |
3615 |
gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg |
3525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Complemental strand, 15762 - 15672
Alignment:
| Q |
27 |
gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg |
117 |
Q |
| |
|
|||| |||||||||| ||||| |||||||| | |||||||||||||| ||| |||||||| ||||| |||||| |||| ||| ||||| |
|
|
| T |
15762 |
gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg |
15672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Original strand, 35477 - 35567
Alignment:
| Q |
27 |
gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg |
117 |
Q |
| |
|
|||| |||||||||| ||||| |||||||| | |||||||||||||| ||| |||||||| ||||| |||||| |||| ||| ||||| |
|
|
| T |
35477 |
gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg |
35567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 117
Target Start/End: Original strand, 49077 - 49167
Alignment:
| Q |
27 |
gggagtagcctttcgggcatgtggagatcagcatgtatttcttggaggttctgctattcatgatggaagcatgatgaaaattaatacttgg |
117 |
Q |
| |
|
|||| |||||||||| ||||| |||||||| | |||||||||||||| ||| |||||||| ||||| |||||| |||| ||| ||||| |
|
|
| T |
49077 |
gggattagcctttcgagcatgcggagatcatctattatttcttggaggtcctgttattcatggtggaataatgatggaaatcaatgcttgg |
49167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University