View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11123_high_30 (Length: 268)

Name: NF11123_high_30
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11123_high_30
NF11123_high_30
[»] chr3 (2 HSPs)
chr3 (37-251)||(28519898-28520112)
chr3 (168-248)||(20135540-20135620)
[»] scaffold0465 (1 HSPs)
scaffold0465 (150-250)||(6424-6524)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 37 - 251
Target Start/End: Complemental strand, 28520112 - 28519898
Alignment:
37 gggtggattttttggccattcgagaatcaaagcttgaggtggttacggagtccgtgtgacgtagcatttggggaggagatgattgtgattgggcctttct 136  Q
    ||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||    
28520112 gggtggagtttttggccattcaagaatcaaagcttgaggtggttacagagtccgtgtgtcgtagcatttggggaggagatgattgtgattgagcctttct 28520013  T
137 tccgaccgtgaggaatagtggtgggatcatttctatttggcgaaaattcggttccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgt 236  Q
    |||| | ||| |||||||||||||||||||||||||||||||||||| |  |||||||||||||||||||||||||||||||||||||||||||||||||    
28520012 tccggctgtggggaatagtggtgggatcatttctatttggcgaaaatccaattccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgt 28519913  T
237 ttagaatggggaagg 251  Q
    |||||||||||||||    
28519912 ttagaatggggaagg 28519898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 248
Target Start/End: Original strand, 20135540 - 20135620
Alignment:
168 tctatttggcgaaaattcggttccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgtttagaatgggga 248  Q
    ||||||||| |||||| || ||| ||| | |||||||| |||| ||| |||||||| ||||||||||||||||||||||||    
20135540 tctatttggagaaaatccgtttcaaacatccttttctcttttgtgggtgaaggctttgtgggagtttgtttagaatgggga 20135620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0465 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0465
Description:

Target: scaffold0465; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 150 - 250
Target Start/End: Complemental strand, 6524 - 6424
Alignment:
150 aatagtggtgggatcatttctatttggcgaaaattcggttccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgtttagaatggggaa 249  Q
    ||||||||||| || |||||||||||| |||||| |  |||||| ||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||    
6524 aatagtggtggtattatttctatttggagaaaatccatttccaatcttcttttctcttttgtgggtgaaggttttgtgggagtttgtttagaatggggaa 6425  T
250 g 250  Q
    |    
6424 g 6424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University