View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_high_38 (Length: 240)
Name: NF11123_high_38
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2681373 - 2681150
Alignment:
| Q |
1 |
atgaatcattgtaaaaccattattata--gatgttatagtatgtgaatcagaagcttaggattgaaacaagaaagaaaccttctaaaatcccgtcatttt |
98 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2681373 |
atgaatcattgtataaccattattatatagatgttatagtatgtgaatcagaagcttaggattgaaacaagaaagaaaccttctaaaatcccatcatttt |
2681274 |
T |
 |
| Q |
99 |
aatggtatttgaagaacaacaagctgagaaaaatgatgaaacacatatgaagaacaacccattgtagttaatgaaggtttcataaattcaccaagacaga |
198 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
2681273 |
aatggtatttgaagaagaacaagctgagaaaactgatgaaacacatatgaagaacaacccattgtagttaatgaaggtttcataaattcatcaagacaaa |
2681174 |
T |
 |
| Q |
199 |
ggtatgtgtcaacaagactagcta |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2681173 |
ggtatgtgtcaacaagactagcta |
2681150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University