View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_high_43 (Length: 226)
Name: NF11123_high_43
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_high_43 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 16005909 - 16005669
Alignment:
| Q |
1 |
tatctctcgggaaagaaactaaagtaaagtcatggaaaaaatatcaaatcaaacttcatcttgttcagcctccagattctgtgcaacttcttcagcttgt |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16005909 |
tatctcttgggaaagaaactaaagtaaagtcatggcaaaaatatcaaatcaaacttcatcttgttcagcctccagattctgtgcaacttcttcagcttgt |
16005810 |
T |
|
| Q |
101 |
tctacct---------------gtgcattttcttctgcgtcaagattttctgcaacttcttgtgcttgatttgccccaacatcatgtgcaatctgtgcat |
185 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16005809 |
tctacctcaatatcatcaacctgtgcattttcttctgcctcaagattttctacaacttcttgtgcttgatttgccccaacaacatgtgcaatctgtgcat |
16005710 |
T |
|
| Q |
186 |
tttcatcttgagcaagttgaccagctgctaacccatcatgc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16005709 |
tttcatcttgagcaagttgaccagctgctaacccatcatgc |
16005669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University