View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_high_45 (Length: 213)
Name: NF11123_high_45
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_high_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 42358452 - 42358636
Alignment:
| Q |
10 |
ggagcagagacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtga |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358452 |
ggagcagaaacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtga |
42358551 |
T |
 |
| Q |
110 |
cggagtgtcctgaagcggagattatagttatggcacttgatctcagttctctcaattctgttacgaacttcgttactcgttttca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42358552 |
cggagtgtcctgaagcggagattatagttatggcacttgatctcagttctgtcaattctgttacgaacttcgttactcgttttca |
42358636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University