View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_high_8 (Length: 409)
Name: NF11123_high_8
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Original strand, 8288355 - 8288736
Alignment:
| Q |
1 |
agaagaaggaatgctgtggaactctaacttatgacacgaggtccacgatttggatgtttgttgtcacattaaaacatacactttagaagttttatgaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8288355 |
agaagaaggaatgctgtggaactctaacttatgacacgaggtccacgatttggatgtttgttgtcacatcaaaacatacactttagaagttttatgaatc |
8288454 |
T |
 |
| Q |
101 |
caaacaaacaaaatgcaagttaaaatagaatttcctatatttgcagctatcaataaaatcagcatggtattgtattagatgagatattctgacttgtaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288455 |
caaacaaacaaaatgcaagttaaaatagaatttcctatatttgcagctatcaataaaatcagcatggtattgtattagatgagatattctgacttgtaag |
8288554 |
T |
 |
| Q |
201 |
gtcgagatctcgaccacttataaacacatattcatatcatatgtacgttatttaaggtgtatgtacctgcataaatcatattctcattgcaatcaattta |
300 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288555 |
gtcgagatctcgaccacttataaaca-----------catatgtatgttatttaaggtgtatgtacctgcataaatcatattctcattgcaatcaattta |
8288643 |
T |
 |
| Q |
301 |
cttgcagctgaacaattcagtatcaaggggtatgtacctgcatatttggatccaaatctcaaatccagtgatcttcttacaggcgtaggcttt |
393 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288644 |
cttgcagctgaacaattcggtatcaaggggtatgtacctgcatatttggatccaaatctcaaatccagtgatcttcttacaggcgtaggcttt |
8288736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University