View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_low_10 (Length: 382)
Name: NF11123_low_10
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 39 - 365
Target Start/End: Original strand, 11729990 - 11730316
Alignment:
| Q |
39 |
gtcacttccgtagctctgaaaagattcttccttggttgaaaaatgttaaagtagcgatagtcgagtttaacgatttgatagaagatatcaatctcaagga |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11729990 |
gtcacttccgtagctctgaaaagattcttccttggttgaaaaatgttaaagtagcgatagtcgagtttaacgatttgatagaagatatcaatctcaagga |
11730089 |
T |
|
| Q |
139 |
gagtattgccggcaatatttcgattttcagatgggtgttaagcttaaagagtcgttatagtgttacgcgtcaagtcacaaaagaccaagggaaactcaaa |
238 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11730090 |
gagtattgctggcaatatttcgattttcagatgggtgttaagcttaaagagtcgttatagtgttacgcgtcaagtcacaaaagagcaagggaaactcaaa |
11730189 |
T |
|
| Q |
239 |
agcttaattgaggaaggaaagagtttaatctctgtagaagaagaacaagcagcagcaggtagcagaaggttttcaaacgaagtgtttgagaaagttactg |
338 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11730190 |
agcttaagtgaggatggaaagagtttaatctctgtagaattagaacaagcagcagcaggtagcagaaggttttcaaacgaagtgtttgagaaagttactg |
11730289 |
T |
|
| Q |
339 |
tggttggaagagaatatgagaagaaag |
365 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11730290 |
tggttggaagagaatatgagaagaaag |
11730316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University