View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_low_24 (Length: 295)
Name: NF11123_low_24
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 52240243 - 52240510
Alignment:
| Q |
18 |
cttataaccctgaagtcgagattttgtgtcaactttaggttttgttacagcttcttgattgattatttgagcaaattctttgaccttccctttaacccgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52240243 |
cttataaccctgaagtcgagattttgtgtcaactttaggttttgttacagcttcttgattgaatatttgagcaaattctttgaccttccctttaacccgg |
52240342 |
T |
|
| Q |
118 |
ccttttcccatacttctgcctgggcttaatgaacctcggggagtagctttgctatattctacacctctcatagaaactgtcttttgcttttcatcttcct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52240343 |
ccttttcccatacttctgcctgggcttaatgaacctcggggagtagctttgctatattctacacctctcatagaaactgtcttttgcttttcatcttcct |
52240442 |
T |
|
| Q |
218 |
tctttggattcataggaatatcaaaactatttgagcttttcgccatgtttgcttctctcgactctctg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52240443 |
tctttggattcataggaatatcaaaactatttgagcttttcgccatgtttgcttctctcgactttctg |
52240510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University