View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_low_27 (Length: 294)
Name: NF11123_low_27
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 50 - 208
Target Start/End: Complemental strand, 8236664 - 8236506
Alignment:
| Q |
50 |
aaggtttataaatattgtctgaaataaataaaaaacgaatttttagttaccggaacattaaggtcgttggtgggaagagaagaataatcttctttgagag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8236664 |
aaggtttataaatattgtctgaaataaataaaaaacgaatttttagttaccggaacattaaggtcgttggtgggtagagaagaataatcttctttgagag |
8236565 |
T |
 |
| Q |
150 |
agaaagtggtgttagggtttgaagtttcatggttttgtttgagggagagacaaagagag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8236564 |
agaaagtggtgttagggtttgaagtttcatggttttgtttgagggagagacaaagagag |
8236506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University