View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_low_30 (Length: 268)
Name: NF11123_low_30
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_low_30 |
 |  |
|
| [»] scaffold0465 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 37 - 251
Target Start/End: Complemental strand, 28520112 - 28519898
Alignment:
| Q |
37 |
gggtggattttttggccattcgagaatcaaagcttgaggtggttacggagtccgtgtgacgtagcatttggggaggagatgattgtgattgggcctttct |
136 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28520112 |
gggtggagtttttggccattcaagaatcaaagcttgaggtggttacagagtccgtgtgtcgtagcatttggggaggagatgattgtgattgagcctttct |
28520013 |
T |
 |
| Q |
137 |
tccgaccgtgaggaatagtggtgggatcatttctatttggcgaaaattcggttccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgt |
236 |
Q |
| |
|
|||| | ||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28520012 |
tccggctgtggggaatagtggtgggatcatttctatttggcgaaaatccaattccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgt |
28519913 |
T |
 |
| Q |
237 |
ttagaatggggaagg |
251 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28519912 |
ttagaatggggaagg |
28519898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 248
Target Start/End: Original strand, 20135540 - 20135620
Alignment:
| Q |
168 |
tctatttggcgaaaattcggttccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgtttagaatgggga |
248 |
Q |
| |
|
||||||||| |||||| || ||| ||| | |||||||| |||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20135540 |
tctatttggagaaaatccgtttcaaacatccttttctcttttgtgggtgaaggctttgtgggagtttgtttagaatgggga |
20135620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0465 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0465
Description:
Target: scaffold0465; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 150 - 250
Target Start/End: Complemental strand, 6524 - 6424
Alignment:
| Q |
150 |
aatagtggtgggatcatttctatttggcgaaaattcggttccaaccttcttttctcctttgcgggagaaggcttcgtgggagtttgtttagaatggggaa |
249 |
Q |
| |
|
||||||||||| || |||||||||||| |||||| | |||||| ||||||||||| |||| ||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
6524 |
aatagtggtggtattatttctatttggagaaaatccatttccaatcttcttttctcttttgtgggtgaaggttttgtgggagtttgtttagaatggggaa |
6425 |
T |
 |
| Q |
250 |
g |
250 |
Q |
| |
|
| |
|
|
| T |
6424 |
g |
6424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University