View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_low_31 (Length: 267)
Name: NF11123_low_31
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 7113755 - 7113533
Alignment:
| Q |
20 |
gctaagtttacggggacatacatgtcacgatttactgcacttgctaaaatcacaaatcacatttatttgtggaatccaaatcccaataaaaacaagaaat |
119 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7113755 |
gctaagtttacgggaacatacatatcacgatttactgcaccggctaaaatcaca-------tttatttgtggaatccaaatcccaataaaaacaagaaat |
7113663 |
T |
|
| Q |
120 |
gacagcaagacattgtaaaatgacataaatggtgttgattttagtgttgaaattgaatatagacaagttgcaatagagaatgaatctgtctgtccctctt |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7113662 |
gacaggaagacattgtaaaatgacataaatggtgttgattttagtgttgaaattgaatatagacaagttgcaatagagaatgaatctgtctgtccctctt |
7113563 |
T |
|
| Q |
220 |
aagtattatatctgtctgtgctgtgcccac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7113562 |
aagtattatatctgtctgtgctgtgcccac |
7113533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University