View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11123_low_35 (Length: 250)
Name: NF11123_low_35
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11123_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 2681452 - 2681688
Alignment:
| Q |
1 |
aagaatcgttgggtcacttctatcacccaatttctttcactttgcttcaggagcatacttatagcataaggaaccaaacaccctttagtgtttttgcaga |
100 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681452 |
aagaatcgttggttcacttctattacccaatttctttcactttgcttcaggagcatacttatagcataaggaaccaaacaccctttagtgtttttgcaga |
2681551 |
T |
|
| Q |
101 |
tgacttcctatctttccacacttcttctggcattttgttaagttgtcttgttggacatctatttagaacttatgttgtgttgtcacaacttatctccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681552 |
tgacttcctatctttccacacttcttctggcattttgttaagttgtcttgttggacatctatttagaacttatgttgtgttgtcacaacttatctccaaa |
2681651 |
T |
|
| Q |
201 |
atgtatttggtactttcttcattttcaacatgcttct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681652 |
atgtatttggtactttcttcattttcaacatgcttct |
2681688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 13125196 - 13125132
Alignment:
| Q |
108 |
ctatctttccacacttcttctggcattttgttaagttgtcttgttggacatctatttagaactta |
172 |
Q |
| |
|
|||||| |||| | || |||||| |||||||| || ||||||||||| ||||||||| ||||||| |
|
|
| T |
13125196 |
ctatctctccataattgttctggaattttgtttagctgtcttgttggtcatctattttgaactta |
13125132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University