View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11123_low_46 (Length: 213)

Name: NF11123_low_46
Description: NF11123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11123_low_46
NF11123_low_46
[»] chr8 (1 HSPs)
chr8 (10-194)||(42358452-42358636)


Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 42358452 - 42358636
Alignment:
10 ggagcagagacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtga 109  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42358452 ggagcagaaacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtga 42358551  T
110 cggagtgtcctgaagcggagattatagttatggcacttgatctcagttctctcaattctgttacgaacttcgttactcgttttca 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
42358552 cggagtgtcctgaagcggagattatagttatggcacttgatctcagttctgtcaattctgttacgaacttcgttactcgttttca 42358636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University