View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11125_high_21 (Length: 359)
Name: NF11125_high_21
Description: NF11125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11125_high_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 19 - 359
Target Start/End: Original strand, 8656161 - 8656502
Alignment:
| Q |
19 |
gaaagggtactccgtggtgctgactgcgtattccaccttgccgcctttgggatgtcaggaaaagagatgctgcaatttggtcgagttgatgaagtcaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656161 |
gaaagggtactccgtggtgctgactgcgtattccaccttgctgcctttgggatgtcaggaaaagagatgctgcaatttggtcgagttgatgaagtcaata |
8656260 |
T |
 |
| Q |
119 |
taaacgggacatgccatatactcgacgcttgcattgaccttggtatcaaaaggcttgtttattgtagcacatacaatgttgtctttggtggtcaaaagat |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656261 |
taaacgggacatgccatatactcgatgcttgcattgaccttggtatcaaaaggcttgtttattgtagcacatacaatgttgtctttggtggtcaaaagat |
8656360 |
T |
 |
| Q |
219 |
acttaacggaaatgaggctttgccgtatttcccaattgatcgtcacgttgatccatacagccgcagtaaatcaattgctgaacagttggttctaaagaat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8656361 |
acttaacggaaatgaggctttgccgtatttcccaattgatcgtcacgttgatccatacagccgcagtaaatcaattgctgaacagttggttctaaagaat |
8656460 |
T |
 |
| Q |
319 |
aatgcccgcactctcaagtaa-ttacttttactcttattatc |
359 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8656461 |
aatgcccgcactctcaagtaatttacttttactcttattatc |
8656502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University