View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11125_high_32 (Length: 249)
Name: NF11125_high_32
Description: NF11125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11125_high_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 7905313 - 7905555
Alignment:
| Q |
1 |
taaggacttgagcagcttacaaacctgcccaggcctaggaggagaaacaccttgaggagggtgcatgtagacatcctcttgaagatcaccgtgcaagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905313 |
taaggacttgagcagcttacaaacctgcccaggcctaggaggagaaacaccttgaggagggtgcatgtagacatcctcttgaagatcaccgtgcaagaag |
7905412 |
T |
|
| Q |
101 |
gcgttgttaacgtctaattggtggagatgccatcgttttatagaagcaacaacaagcaacaatcaaacagttgacagtttttccaccagagagagtgcnn |
200 |
Q |
| |
|
| ||||||| |||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
7905413 |
gtgttgttagcgtctaattggtggagatgccatcgtttaatagaagtaacagcaagcaacaatcaaacaattgacagttttgccaccagagagagtgtaa |
7905512 |
T |
|
| Q |
201 |
nnnnnnnntccacgccttcgatttgattgtaaccctttgctac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7905513 |
aaaaaaaatccacgccttcgatttgattgtaacccttggctac |
7905555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University