View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11125_high_35 (Length: 241)
Name: NF11125_high_35
Description: NF11125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11125_high_35 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 22 - 241
Target Start/End: Original strand, 7905083 - 7905302
Alignment:
| Q |
22 |
aggtctttgatacgaaaatgatgatcaagcaattgcttaatctcagcaaaagcagcaaggcagtcaccagccaatataatgtcattcacgtatattaata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905083 |
aggtctttgatacgaaaatgatgatcaagcaattgcttaatctcagcaaaagcagcaaggcagtcaccagccaatataatgtcattcacgtatattaata |
7905182 |
T |
|
| Q |
122 |
aagctgtgaaagaagttggagaagcacgaattaaaaaggagtgatcagctgaagcttgcacaaaaccaatggtcaggaggagtgaaataagcttttcaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905183 |
aagctgtgaaagaagttggagaagcacgaattaaaaaggagtgatcagctgaagcttgcacaaaaccaatggtcaggaggagtgaaataagcttttcaaa |
7905282 |
T |
|
| Q |
222 |
ccaacgccggctggcatgtt |
241 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
7905283 |
ccaacgccggctggcttgtt |
7905302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University